View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_low_126 (Length: 224)
Name: NF5717_low_126
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_low_126 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 46098054 - 46097865
Alignment:
| Q |
19 |
attgaagtaaggggaaggggtcccgaaccaataaaagcaattttgttagggacatgagtgcagtgttggctaaggatagaaaactcaaggtgaccaagtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46098054 |
attgaagtaaggggaaggggtcccgaaccaataaaagcaattttgttagggacatgagtgcagtgttggctaaggatagaaaactcaaggtgaccaagtt |
46097955 |
T |
 |
| Q |
119 |
tgatgtagtttgaataataagggaaaatatggagatgattaagagggttttggtatgagcctaagatggctgaatagtgtctctccaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46097954 |
tgatgtagtttgaataataagggaaaatatggagatgattaagagggttttggtatgagcctaagatggctgaatagtgtctctccaaat |
46097865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 21 - 146
Target Start/End: Complemental strand, 37484816 - 37484691
Alignment:
| Q |
21 |
tgaagtaaggggaaggggtcccgaaccaataaaagcaattttgttagggacatgagtgcagtgttggctaaggatagaaaactcaaggtgaccaagtttg |
120 |
Q |
| |
|
||||||||| ||||| || || || |||||||| |||||||| ||||| |||| |||| |||||| | | | |||| || |||||| ||| ||||||| |
|
|
| T |
37484816 |
tgaagtaagtggaagtggacctgagccaataaaggcaatttttttaggaacattagtggagtgtttggttaagatattgaattcaaggagactaagtttg |
37484717 |
T |
 |
| Q |
121 |
atgtagtttgaataataagggaaaat |
146 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
37484716 |
aggtagtttgaataataagggaaaat |
37484691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University