View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_low_34 (Length: 397)
Name: NF5717_low_34
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_low_34 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 120 - 397
Target Start/End: Complemental strand, 21162002 - 21161724
Alignment:
| Q |
120 |
caattgctttcactttgatgaatc-ttctacaccagtaaactgatttcaccaaatccggcattctttttagcaaatcaaacgcacgcactcacaccattc |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21162002 |
caattgctttcactttgatgaatcgttctacactagtaaactgatttcaccaaatccggcattctttttagcaaatcaaacgcacccactcacaccattc |
21161903 |
T |
 |
| Q |
219 |
attgtattgaactattctctgcaacttcattctttcaaagctcattcttaaatctcaatcattattgcaatcaaattcacaatgccatttttaaggttaa |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21161902 |
attgtattgaactattctctgcaacttcattctttcgaagctcattctcaaatctcaatcattattgcaatcaaattcacaatgccatttttaaggttaa |
21161803 |
T |
 |
| Q |
319 |
ggtacaaagctcttagtgtttcttttaatgccaatttgattcttcatcctcgattattacactcattcaataatcctct |
397 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21161802 |
ggtacaaagctctttgtgtttcttttaatgccaatttgattcttcatcctcgattattacactcattcaataatcctct |
21161724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University