View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_low_42 (Length: 372)
Name: NF5717_low_42
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 20 - 251
Target Start/End: Complemental strand, 38446233 - 38446002
Alignment:
| Q |
20 |
ttgatgtttcagctggtgagttaccgtttgtttccggttcctgtaaaaatatgaaatcgttaaaacgaggatgaagtatgagagtgaaagtatgatatga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38446233 |
ttgatgtttcagctggtgagttaccgtttgtttccggttcctgtaaaaatatgaaatcgttaaaacaaggatgaagtatgagagtgaaagtatgatatga |
38446134 |
T |
|
| Q |
120 |
atgaatgaattgataccgttgatattgaagaagggagtcttttaacggagtagatgcgttttcctgggtggcgatcgaagatgtgaaagaaacctgacat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38446133 |
atgaatgaattgataccgttgatattgaagaagggagtcttttaacggagtagatgcgttttcctgggtggcgatcgaagatgtgaaagaaacctgacat |
38446034 |
T |
|
| Q |
220 |
gcaccctatttgtttttggatttgtttctcaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38446033 |
gcaccctatttgtttttggatttgtttctcaa |
38446002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 318 - 367
Target Start/End: Complemental strand, 38445935 - 38445886
Alignment:
| Q |
318 |
caatattgtgaagagtttctcacattctgttctgctgcttctctgctcct |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38445935 |
caatattgtgaagagtttctcacattctgttctgctgcttctctgttcct |
38445886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University