View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_low_57 (Length: 318)
Name: NF5717_low_57
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_low_57 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 55 - 311
Target Start/End: Original strand, 11897379 - 11897617
Alignment:
| Q |
55 |
gttaaattcaatggatctttctcaaatccctaaggctcatcatcgtagacgcagtggagcctctggtcttctgccaaattttcactaggctcaatgttat |
154 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
11897379 |
gttaaattcaatggatctttcttaaatccctaaggctcatcatcgtagacgcagtggagcctctggtcttctgccaaatt------------------at |
11897460 |
T |
 |
| Q |
155 |
tggtttcgacaaccannnnnnngttgcatttcagcctctaaagctgctttccacttttttcggccacataggtcgtaatcttagcccaagcactaggctc |
254 |
Q |
| |
|
|| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11897461 |
tgatttcgacaaccatttttttgttgcatttcaacctctaaagctgctttccacttttttcggccacataggccgtaatcttagcccaagcactaggctc |
11897560 |
T |
 |
| Q |
255 |
ggacattttaattttcatcatttccccaaccagttggtgggattaccccttcctctg |
311 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11897561 |
agacattttaattttcatcatttccctaaccagttggtgggattaccccttcctctg |
11897617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University