View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_low_65 (Length: 301)
Name: NF5717_low_65
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_low_65 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 67 - 285
Target Start/End: Original strand, 41189004 - 41189222
Alignment:
| Q |
67 |
gaaaaagttaaagggtggattatataattatatacttatctcatattttcattgatggcgtaagtaccgttaattttttataatgtaatcttatctttat |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41189004 |
gaaaaagttaaagggtggattatataattatatacttatctcatattttcattgatggcgtaagtaccgttaattttttataatgtaatcttatctttat |
41189103 |
T |
 |
| Q |
167 |
cttaaaagacttcatagcatcactcaccaccacaaacatatatagtgtgttagtataaacccagacaaatgatgcaacattccactttacatatatatct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41189104 |
cttaaaagacttcatagcatcactcaccaccacaaacatatatagtgtgttagtataaacccagacaaatgatgcaacattccactttacatatatatct |
41189203 |
T |
 |
| Q |
267 |
acttatcatgttaattgtg |
285 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
41189204 |
acttatcatgttaattgtg |
41189222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University