View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_low_83 (Length: 256)
Name: NF5717_low_83
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_low_83 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 20 - 168
Target Start/End: Original strand, 47150434 - 47150582
Alignment:
| Q |
20 |
tgatctttatgatgattgatcttttaaaattgacgattgaaagaccgcgaaatggatagggatccttaaatcgtagggtacaattggtcacgtgtcgagt |
119 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47150434 |
tgatctttatgattattgatcttttaaaattgacgattgaaagaccgcgaaatggatagggatccttaaatcgtagggtacaattggtcacgtgtcgagt |
47150533 |
T |
|
| Q |
120 |
aaataggacccatggtccatatgattcattcatcttcaaggctagctag |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47150534 |
aaataggacccatggtccatatgattcattcatcttcaaggctagctag |
47150582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 228 - 256
Target Start/End: Original strand, 47150653 - 47150681
Alignment:
| Q |
228 |
cttttcctcgccctctatagctagcattt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47150653 |
cttttcctcgccctctatagctagcattt |
47150681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University