View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5717_low_94 (Length: 251)
Name: NF5717_low_94
Description: NF5717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5717_low_94 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 11 - 219
Target Start/End: Complemental strand, 3492405 - 3492197
Alignment:
| Q |
11 |
cagagagaaagaaagagggagatatggcagatatgggatctagaagggtatgtgacaatgtgtgtggctgcacaattccgtgtcctggtggttccacttg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3492405 |
cagagagaaagaaagagggagatatggcagatatgggatctagaatggtatgtgacaatgtgtgtggctgcacaattccgtgtgctggtggttccacttg |
3492306 |
T |
|
| Q |
111 |
caggtaaatttcttttgtttttcgtggtcttgttaagttaaatattatttaatatctttgtaatagccatttctacattttctattttcttaaatgacca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3492305 |
caggtaaatttcttttgtttttcgtggtcttgttaagttaaatattatttaatatctttgtaatagccatttctacattttctattttcttaagtgacca |
3492206 |
T |
|
| Q |
211 |
atgttatta |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
3492205 |
atgttatta |
3492197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University