View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5718_high_4 (Length: 506)
Name: NF5718_high_4
Description: NF5718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5718_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 7e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 7e-81
Query Start/End: Original strand, 17 - 169
Target Start/End: Original strand, 1202194 - 1202346
Alignment:
| Q |
17 |
aatattgccttggttccatggtggctatctgcagatggcatgaagctggttgggtgttaggggtcgcaatttcttgtgctggaatgaatacatatataat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1202194 |
aatattgccttggttccatggtggctatctgcagatggcatgaagctggttgggtgttaggggtcgcaatttcttgtgctggaatgaatacatatataat |
1202293 |
T |
 |
| Q |
117 |
ttatatagcgtcatggttctgcgattgttgtcacagatgaacaagctcgatga |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1202294 |
ttatatagcgtcatggttctgcgattgttgtcacagatgaacaagctcgatga |
1202346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 351 - 498
Target Start/End: Original strand, 1202443 - 1202590
Alignment:
| Q |
351 |
ttcaggttcaggttcaaaatgaaactctctcaatctagtaagtatgtgtgtagtctacttccaggtagtttggaagtgaggtattcagttcaaaaatttg |
450 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1202443 |
ttcaggttcagattcaaaatgaaactctctcaatctagtaagtatgtgtgtagtctacttccaggtagtttggaagtgaggtattcagttcaaaaatttg |
1202542 |
T |
 |
| Q |
451 |
atagttcttcttagttaataaatttatatttttctccttttgatgatg |
498 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1202543 |
atagttcttcttagttaataaatttatatttttctccttttgatgatg |
1202590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 17 - 60
Target Start/End: Original strand, 22776491 - 22776534
Alignment:
| Q |
17 |
aatattgccttggttccatggtggctatctgcagatggcatgaa |
60 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
22776491 |
aatattgccttggttccatggtgccaatctgcagatggcatgaa |
22776534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 17 - 60
Target Start/End: Original strand, 34939896 - 34939939
Alignment:
| Q |
17 |
aatattgccttggttccatggtggctatctgcagatggcatgaa |
60 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
34939896 |
aatattgccttggttccatggtgcctatatgcagatggcatgaa |
34939939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University