View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5718_low_15 (Length: 298)
Name: NF5718_low_15
Description: NF5718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5718_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 115 - 279
Target Start/End: Complemental strand, 39088230 - 39088066
Alignment:
| Q |
115 |
ctgaattctataactagttagtttggcttttcaaccatttgtatatttattttactgaaaatgttgttaattcctatgcagattcaatgaaaaaaggttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088230 |
ctgaattctataactagttagtttggcttttcaaccatttgtatatttattttactgaaaatgttgttaattcctatgcagattcaatgaaaaaaggttc |
39088131 |
T |
 |
| Q |
215 |
aagatcagtgaatgttgaagaggacacaaatgagttgcccttgcctaaatcatctaagcaacact |
279 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088130 |
aaggtcagtgaatgttgaagaggacacaaatgagttgcccttgcctaaatcatctaagcaacact |
39088066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 39088409 - 39088334
Alignment:
| Q |
1 |
ctgatgattcagaaccccgagtctccttaggtacacgttatgtttcatgcttaatttttgacatacaaaatgtagt |
76 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088409 |
ctgatgattcagaaccccgaatctccttaggtacgcgttatgtttcatgcttaatttttgacatacaaaatgtagt |
39088334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University