View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5718_low_20 (Length: 253)
Name: NF5718_low_20
Description: NF5718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5718_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 244
Target Start/End: Original strand, 5665318 - 5665546
Alignment:
| Q |
15 |
acaaaggagaggataaggggttatttttcgggagcagacggatatagctgcctaaagggagcaatagattgaggaggaggactttgaccagggaaaggag |
114 |
Q |
| |
|
|||||| ||||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5665318 |
acaaagaagagggtaaggggttatttt-cgggagcagacagatatagctgcctaaagggagcaatagattgaggaggaggactttgaccatggaaaggag |
5665416 |
T |
 |
| Q |
115 |
gaggagttcgacaatatcatggtcgaccagcatgacacttccgggtttggcccaaattttatgtgattatgcacttttcttatcactaatgtagttgttt |
214 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5665417 |
gaggagtttgacaatatcatggtcgaccagcatgacacttccgggtttggcccaaattttatgtgattatgcacttttcttatcactaatgtagttgttt |
5665516 |
T |
 |
| Q |
215 |
ttattttcatgtagttgttctaagaataat |
244 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
5665517 |
ttattttcatgtagttgttctaaaaataat |
5665546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University