View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5718_low_25 (Length: 229)
Name: NF5718_low_25
Description: NF5718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5718_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 88 - 210
Target Start/End: Complemental strand, 7722723 - 7722601
Alignment:
| Q |
88 |
atgatgggttggtcaaaagagcccacgtgactagagggaacggtcttcaagggatctatctatctgcaaggtttttctccgatcacgaggctttattagt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722723 |
atgatgggttggtcaaaagagcccacgtgactagagggaacggtcttcaagggatctatctatctgcaaggtttttctccgatcacgaggctttattagt |
7722624 |
T |
 |
| Q |
188 |
gtctcaaaaacctctgtccgtat |
210 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7722623 |
gtctcaaaaacctctgtccgtat |
7722601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 4 - 67
Target Start/End: Complemental strand, 7722812 - 7722749
Alignment:
| Q |
4 |
ataatgcatagtttcaatttatactagtagaaagatcataaagataaagaaagagaaagagagg |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722812 |
ataatgcatagtttcaatttatactagtagaaagatcataaagataaagaaagagaaagagagg |
7722749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University