View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5719-Insertion-7 (Length: 269)
Name: NF5719-Insertion-7
Description: NF5719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5719-Insertion-7 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 123 - 269
Target Start/End: Complemental strand, 8131134 - 8130981
Alignment:
| Q |
123 |
tttgcttcaccaagtgcctcttcgatctcctgttggaccatgaacaccctc------gtcttcattttccgtaggctgaaatcattattgtctatgcatt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8131134 |
tttgcttcaccaagtgcctcttcgatctcctgttggaccatgaacaccctcaccctcgtcttcattttccgcaggctgaaatcattattgtctatgcatt |
8131035 |
T |
 |
| Q |
217 |
tctcgatattgaaattcgcagatttgtagagtaagccacaaacaa-gacaatca |
269 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
8131034 |
tctcgatattgaaattcgcagagatgtagagtaagccacaaacaacgacaatca |
8130981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 78 - 123
Target Start/End: Complemental strand, 8131230 - 8131185
Alignment:
| Q |
78 |
gagccaaatcgtagaagcaatcttcctcttcgaatcaaggcattat |
123 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8131230 |
gagccaaatcgtagaaccaatcttcctcttcgaatcaaggcattat |
8131185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University