View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5719_high_21 (Length: 207)
Name: NF5719_high_21
Description: NF5719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5719_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 18 - 194
Target Start/End: Original strand, 32856086 - 32856262
Alignment:
| Q |
18 |
gtgtattattggaaaagaaaaataaaatgtttttactcnnnnnnnnnacctttgtcctagtggcagaggaggcaagagaaattgaagtagaaggatttga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32856086 |
gtgtattattggaaaagaaaaataaaatgtttttactctttttttttacctttgtcctagtggcagaggaggtaagagaaattgaagtagaaggatttga |
32856185 |
T |
 |
| Q |
118 |
tgactttgcaaaagaagacaacccaacattgtaagccatactttcatcaggctcaaataaaccatagctcctctctg |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32856186 |
tgactttgcaaaagaagacaacccaacattgtaagtcatactttcatcaggctcaaataaaccatagttcctctctg |
32856262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University