View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5719_low_11 (Length: 349)
Name: NF5719_low_11
Description: NF5719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5719_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 8 - 188
Target Start/End: Complemental strand, 8131503 - 8131323
Alignment:
| Q |
8 |
cagcagagagacttcttttgatccataatgaacttcttcaaaaccttagatatgtagtccttttggttgatgaataaggttatcttggatttataccttg |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8131503 |
cagctgagagacttcttttgatccataatgaacttcttcaaaaccttatatatgtagtccttttggttgatgaataaggttatcttggatttataccttg |
8131404 |
T |
|
| Q |
108 |
tgatatgcataaccataatctttttagcaccccacatattcttcatttcaatctaactctcaagattcatctttaccttct |
188 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8131403 |
tgatctgcataaccataatctttttagcaccccacgtattcttcatttcaatctaactctcaagattcatctttaccttct |
8131323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University