View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5719_low_17 (Length: 239)
Name: NF5719_low_17
Description: NF5719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5719_low_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 53878707 - 53878928
Alignment:
| Q |
18 |
gggtgaagatggattggtagattgagaggatggagagagggagggttgtgaggaggaagatggttatgaaaaggaatttgtttgtggttaggattttgag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
53878707 |
gggtgaagatggattggtagattgagaggatggagagagggagggttgtgaggaggaagatggttgtgaaaaggaatttgtttgtggttaggatttggag |
53878806 |
T |
|
| Q |
118 |
agagttgaataggattttgaatggggtgaagcaacgccatacagcgccggcatcgcacatctcttactggctactgtcggcggatcatggaggaggaaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53878807 |
agagttgaataggattttgaatggggtgaagcaacgccatacagcgccggcatcgcacatctcttactggctactgtcggtggatcatggaggaggaaga |
53878906 |
T |
|
| Q |
218 |
tgatgatggttttaggtttcct |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
53878907 |
tgatgatggttttaggtttcct |
53878928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University