View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5720-Insertion-2 (Length: 510)
Name: NF5720-Insertion-2
Description: NF5720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5720-Insertion-2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 47; Significance: 1e-17; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 7 - 57
Target Start/End: Complemental strand, 4499432 - 4499382
Alignment:
| Q |
7 |
attatgaacagcaccccattttttcatcaccataacttgcaacataattgc |
57 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4499432 |
attatgaacagcaccccattttttcatcacaataacttgcaacataattgc |
4499382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 447 - 486
Target Start/End: Complemental strand, 4498925 - 4498886
Alignment:
| Q |
447 |
aatacgagacctcaatacaacttcaatatcgaccagactc |
486 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4498925 |
aatacgagacttcaatacaacttcaatatcgaccagactc |
4498886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 317 - 373
Target Start/End: Complemental strand, 4499204 - 4499146
Alignment:
| Q |
317 |
atgctcactttattgcggttcttctat--gagtatttatgctttgattgttattccctc |
373 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||| || |||||||||||||||||| |
|
|
| T |
4499204 |
atgctcactttattgcggttcgtctatctgagtatttctgttttgattgttattccctc |
4499146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University