View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5720-Insertion-6 (Length: 166)
Name: NF5720-Insertion-6
Description: NF5720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5720-Insertion-6 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 2e-84; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 5 - 166
Target Start/End: Original strand, 41459315 - 41459476
Alignment:
| Q |
5 |
acatattcctgtatttggttgcaggattataatgcaaagctttctgattttgggctggcaagggatggttcaacaggtgacaaaagtcacatcttcacca |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41459315 |
acatattcctgtatttggttgcaggattataatgcaaagctttctgattttgggctggcaagggatggtccaacaggtgacaaaagtcacatcttcacca |
41459414 |
T |
|
| Q |
105 |
acacgttagtaggaaataatggatatgcagctcctgaatatgtagattcaggtattttccgg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41459415 |
acacgttagtaggaaataatggatatgcagctcctgaatatgtagattcaggtattttccgg |
41459476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 17 - 162
Target Start/End: Original strand, 41442537 - 41442679
Alignment:
| Q |
17 |
atttggttgcaggattataatgcaaagctttctgattttgggctggcaagggatggttcaacaggtgacaaaagtcacatcttcaccaacacgttagtag |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||| ||| ||| ||| || | || | | |
|
|
| T |
41442537 |
atttgattgcaggattataatgcaaagctttctgatttcgggctggcaaaggatggtccaacaggtgacaaaagccacgtct---ccaccagggtaatgg |
41442633 |
T |
|
| Q |
117 |
gaaataatggatatgcagctcctgaatatgtagattcaggtatttt |
162 |
Q |
| |
|
||| ||||||||||||||||||||||| ||| | |||||||||| |
|
|
| T |
41442634 |
gaacctatggatatgcagctcctgaatatctagctacaggtatttt |
41442679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 58 - 104
Target Start/End: Original strand, 41448986 - 41449032
Alignment:
| Q |
58 |
gctggcaagggatggttcaacaggtgacaaaagtcacatcttcacca |
104 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||| ||| ||||| |
|
|
| T |
41448986 |
gctggcaagggatggtccaacaggtgagaaaagtcacgtctccacca |
41449032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University