View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5720-Insertion-7 (Length: 160)
Name: NF5720-Insertion-7
Description: NF5720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5720-Insertion-7 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 5e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 5e-39
Query Start/End: Original strand, 40 - 160
Target Start/End: Original strand, 7234926 - 7235045
Alignment:
| Q |
40 |
catttacttcccgtgtggttcctcttgnnnnnnnnnaaatttctcttcatatgaaattctcttaataatt-aattaatttgaatattgatgctgaacatc |
138 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7234926 |
catttacttcccgtgtggttcctcttgttttttt--aaatttctcttcatatgaaattctcttaataatttaattaatttgaatattgatgctgaacatc |
7235023 |
T |
 |
| Q |
139 |
ttcatattgttcatgcttcaca |
160 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7235024 |
ttcatattgttcatgcttcaca |
7235045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University