View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5720_low_5 (Length: 321)
Name: NF5720_low_5
Description: NF5720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5720_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 65 - 304
Target Start/End: Original strand, 39424549 - 39424788
Alignment:
| Q |
65 |
tagctgagaaactaaacttaatattttatttt-tggttttctatttgtttattagacttgcaacaagataaaataccaaatgtgttatccccttagtctg |
163 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39424549 |
tagctgagaaactaaacttaatatttttttttttggttttctatttgtttattagacttgcaacaagataaaataccaaatgtgttatccccttagtctg |
39424648 |
T |
 |
| Q |
164 |
gaaacgaattgacggatttgacaaagtggtagaccgccatgtgctcctgttgtccttccacatgcaatattaggcatttcatgctcattctcaatcgtat |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
39424649 |
gaaacgaattgacggatttgacaaagtggtacaccgccatgtgctcctgttgtccttccacatgcaatattaggcatttcatgctcattgtc-atcgtat |
39424747 |
T |
 |
| Q |
264 |
ctctttttctttgcagcaaaagatggaagacacatgttact |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39424748 |
ctctttttctttgcagcaaaagatggaagacacatgttact |
39424788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University