View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5721-Insertion-11 (Length: 235)
Name: NF5721-Insertion-11
Description: NF5721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5721-Insertion-11 |
 | |
|
| [»] scaffold0398 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0398 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: scaffold0398
Description:
Target: scaffold0398; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 16117 - 16337
Alignment:
| Q |
7 |
ataaatcacacaagtaacattaggaaaagaagaacatgattatggtatctcttccttttgtgttcttctgcttagttcttggttttggtttttatttctt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16117 |
ataaatcacacaagtaacattaggaaaagaagaacatgattatggtatctcttccttttgtgttcttctgcttagttcttggttttggtttttatttctt |
16216 |
T |
|
| Q |
107 |
tggaagtgctagaggaagacgtgatgtatacacaaaccctcaagtttatggtatgccaattccaccacgaggcactgcaattgcaaatagtaccttccct |
206 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16217 |
tggaagtgctagaggaagacgtggtgtatacacaaaccctcaagtttatggtatgccaattccaccacgaggcactgcaattgcaaatagtaccttccct |
16316 |
T |
|
| Q |
207 |
taatcttcttctccaatccaa |
227 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
16317 |
taatcttcttctccaacccaa |
16337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 43040366 - 43040146
Alignment:
| Q |
7 |
ataaatcacacaagtaacattaggaaaagaagaacatgattatggtatctcttccttttgtgttcttctgcttagttcttggttttggtttttatttctt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43040366 |
ataaatcacacaagtaacattaggaaaagaagaacatgattatggtatctcttccttttgtgttcttctgcttagttcttggttttggtttttatttctt |
43040267 |
T |
|
| Q |
107 |
tggaagtgctagaggaagacgtgatgtatacacaaaccctcaagtttatggtatgccaattccaccacgaggcactgcaattgcaaatagtaccttccct |
206 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43040266 |
tggaagtgctagaggaagacgtggtgtatacacaaaccctcaagtttatggtatgccaattccaccacgaggcactgcaattgcaaatagtaccttccct |
43040167 |
T |
|
| Q |
207 |
taatcttcttctccaatccaa |
227 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
43040166 |
taatcttcttctccaacccaa |
43040146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 52 - 221
Target Start/End: Complemental strand, 43044842 - 43044673
Alignment:
| Q |
52 |
tatctcttccttttgtgttcttctgcttagttcttggttttggtttttatttctttggaagtgctagaggaagacgtgatgtatacacaaaccctcaagt |
151 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43044842 |
tatctcttccttttatattcttctgcttagttattggttttggttgttacttctttggaagagctagaggaagacgtgatgtatacacaaaccctcaagt |
43044743 |
T |
|
| Q |
152 |
ttatggtatgccaattccaccacgaggcactgcaattgcaaatagtaccttcccttaatcttcttctcca |
221 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||| ||||||||| ||| ||| ||||| |
|
|
| T |
43044742 |
ttatggtatgccaattccaccaccaggcactgctgctgcaaatagttccttcccttcatcatctcctcca |
43044673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University