View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5721-Insertion-12 (Length: 172)
Name: NF5721-Insertion-12
Description: NF5721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5721-Insertion-12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 6e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 6e-78
Query Start/End: Original strand, 8 - 172
Target Start/End: Original strand, 4339104 - 4339268
Alignment:
| Q |
8 |
gattaatctattttctaacgatgagacgttaatgatatgaaaattgttgttatttttattcaaccgtgkgataaaatttgaggatgggttgsataatcmg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||| | |
|
|
| T |
4339104 |
gattaatctattttctaacgatgagacgttaatgatatgaaaattgttgttatttttattcaacggtgttataaaatttgaggatgggttgcataatcag |
4339203 |
T |
|
| Q |
108 |
tgatcmctcttactcttctcttgatattgcagatgaggagacagggtggtatgacggtcaggtat |
172 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4339204 |
tgatcattcttactcttctcttgatattgcagatgaggagacagggtggtatgacggtcaggtat |
4339268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University