View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5721_high_22 (Length: 265)
Name: NF5721_high_22
Description: NF5721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5721_high_22 |
 |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 33804927 - 33805185
Alignment:
| Q |
1 |
acccctttaactgtattttccttgagaaacaaacttactgctcattggaaagatctagggcgatggggagttcaagttattaggaaaggattctatgaat |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33804927 |
acccctctaactgtattttccttgagaaacaaacttactgctcattggaaagatctagggcgatggggagttcaagttattaggaaaggattctatgaat |
33805026 |
T |
 |
| Q |
101 |
ttactttctccaacttagaagatctgaagagggtaatatccattggctcatggaatttgagtcccggcttcatcaaattctttgcttggacgcgtgatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33805027 |
ttactttctccaacttagaagatctgcagagggtaatatccattggctcatagaatttgagtcccggcttcatcaaattctttgcttggacgcgtgatta |
33805126 |
T |
 |
| Q |
201 |
tagccctaatacacgtcaaaatacttcagctcaagtatggctcaagatcgatgatgtcc |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
33805127 |
tagccctaatacacgtcaaaatacttcagctcaagtatggctcaagatctatggtgtcc |
33805185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 142 - 236
Target Start/End: Complemental strand, 45900 - 45806
Alignment:
| Q |
142 |
attggctcatggaatttgagtcccggcttcatcaaattctttgcttggacgcgtgattatagccctaatacacgtcaaaatacttcagctcaagt |
236 |
Q |
| |
|
|||||||| |||||||||| || || ||||| || |||||||||||||| ||||||| |||||||||||| | ||||| || ||||||||||| |
|
|
| T |
45900 |
attggctcctggaatttgaatctaggtttcataaagttctttgcttggactcgtgattttagccctaatacccagcaaaacacctcagctcaagt |
45806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University