View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5721_high_26 (Length: 244)

Name: NF5721_high_26
Description: NF5721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5721_high_26
NF5721_high_26
[»] chr2 (1 HSPs)
chr2 (1-228)||(11548164-11548391)


Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 11548391 - 11548164
Alignment:
1 tcttgaacttttaactcttcaattacttttaactcttcgccttggtaattatgcaattgctttagtgtttgatgaatttgacaaattcaaattcaggttc 100  Q
    |||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
11548391 tcttgaacttttaatttttcaattacttttaactcttcgccttggtaattatgcaattgctttagtgtttgatgaatttgacaaattcaaattcaagttc 11548292  T
101 aaaatatagtttgtagttgacttcggattatgaaatcttaggattttacgtgggggataaagtagattcgtttggtgattggtatgcaatgaatttgaca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||    
11548291 aaaatatagtttgtagttgacttcggattatgaaatcttaggattttacgtgggggataaagtagtttcgtttggtaattggtatgcaatgaatttgaca 11548192  T
201 gattagattcaagataaagtttcttagt 228  Q
     |||||||||||||||||||||||||||    
11548191 aattagattcaagataaagtttcttagt 11548164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University