View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5721_high_26 (Length: 244)
Name: NF5721_high_26
Description: NF5721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5721_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 11548391 - 11548164
Alignment:
| Q |
1 |
tcttgaacttttaactcttcaattacttttaactcttcgccttggtaattatgcaattgctttagtgtttgatgaatttgacaaattcaaattcaggttc |
100 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
11548391 |
tcttgaacttttaatttttcaattacttttaactcttcgccttggtaattatgcaattgctttagtgtttgatgaatttgacaaattcaaattcaagttc |
11548292 |
T |
 |
| Q |
101 |
aaaatatagtttgtagttgacttcggattatgaaatcttaggattttacgtgggggataaagtagattcgtttggtgattggtatgcaatgaatttgaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
11548291 |
aaaatatagtttgtagttgacttcggattatgaaatcttaggattttacgtgggggataaagtagtttcgtttggtaattggtatgcaatgaatttgaca |
11548192 |
T |
 |
| Q |
201 |
gattagattcaagataaagtttcttagt |
228 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
11548191 |
aattagattcaagataaagtttcttagt |
11548164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University