View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5721_high_27 (Length: 242)

Name: NF5721_high_27
Description: NF5721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5721_high_27
NF5721_high_27
[»] chr7 (2 HSPs)
chr7 (127-204)||(43317319-43317396)
chr7 (1-38)||(43317692-43317729)


Alignment Details
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 127 - 204
Target Start/End: Complemental strand, 43317396 - 43317319
Alignment:
127 catcattctttatctcgaaatatatagatgcccatccccaccaccaaccatgctttattgtaaaaatccaaatccagt 204  Q
    |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
43317396 catcattctttatctcgaaatacatagaagcccatccccaccaccaaccatgctttattgtaaaaatccaaatccagt 43317319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 43317729 - 43317692
Alignment:
1 tcaattacagtttgtaaactacagcattgtttgaaaag 38  Q
    ||||||||||||||||||||||||||||||||||||||    
43317729 tcaattacagtttgtaaactacagcattgtttgaaaag 43317692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University