View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5721_low_31 (Length: 246)
Name: NF5721_low_31
Description: NF5721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5721_low_31 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 20801809 - 20801581
Alignment:
| Q |
18 |
ttattaaatatcttccttggacaannnnnnnagcaacacttttggcatatatataccttgttttctgccatgtttttctcaatggaagaaaactcatgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20801809 |
ttattaaatatcttccttggacaatttatttagcaacacttttggcatatatataccttgttttctgccatgtttttctcaatggaagaaaactcatgtt |
20801710 |
T |
 |
| Q |
118 |
tattggatgattcccacaaaccatgaaagtggacatcactattggaatctaacatgtatgttctcatgcgtgcactcactttagaaaagttcattttggt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20801709 |
tattggatgattcccacaaaccatgaaagtggacatcactattggaatctgacatatatgttctcatgcgtgcactcactttagaaaagttcattttggt |
20801610 |
T |
 |
| Q |
218 |
aaaacatatgctttagctttatgttatgt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20801609 |
aaaacatatgctttagctttatgttatgt |
20801581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University