View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5721_low_31 (Length: 246)

Name: NF5721_low_31
Description: NF5721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5721_low_31
NF5721_low_31
[»] chr3 (1 HSPs)
chr3 (18-246)||(20801581-20801809)


Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 20801809 - 20801581
Alignment:
18 ttattaaatatcttccttggacaannnnnnnagcaacacttttggcatatatataccttgttttctgccatgtttttctcaatggaagaaaactcatgtt 117  Q
    ||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20801809 ttattaaatatcttccttggacaatttatttagcaacacttttggcatatatataccttgttttctgccatgtttttctcaatggaagaaaactcatgtt 20801710  T
118 tattggatgattcccacaaaccatgaaagtggacatcactattggaatctaacatgtatgttctcatgcgtgcactcactttagaaaagttcattttggt 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||    
20801709 tattggatgattcccacaaaccatgaaagtggacatcactattggaatctgacatatatgttctcatgcgtgcactcactttagaaaagttcattttggt 20801610  T
218 aaaacatatgctttagctttatgttatgt 246  Q
    |||||||||||||||||||||||||||||    
20801609 aaaacatatgctttagctttatgttatgt 20801581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University