View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5721_low_34 (Length: 238)
Name: NF5721_low_34
Description: NF5721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5721_low_34 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 11548972 - 11548752
Alignment:
| Q |
18 |
agaaccataactcatcataaaacgtctccataaagaatatgaaacgattctacgaagaatcaaccggaacactttgcttgcgttttccgaaaattcaact |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
11548972 |
agaaccataactcatcataaaacgactccataaagaatatgaaacgattctacgaagaatcaaccggaacactttgtttgcgttttctgaaaattcaacc |
11548873 |
T |
|
| Q |
118 |
gaaatgttttgcatttgttttcagggaatcaaagatcgggcattgattctggtaacacaaaacatgatttcatgaacgattccggcaaacccagtaaaca |
217 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11548872 |
gaaatgttctgcatttgttttcagggaatcaaagatcgggcattgattctggtaacacaaaacatgatttcatgaacgatttcggcaaacccagtaaaca |
11548773 |
T |
|
| Q |
218 |
tcaaacatcaatcagtgattc |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
11548772 |
tcaaacatcaatcagtgattc |
11548752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University