View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5721_low_36 (Length: 234)

Name: NF5721_low_36
Description: NF5721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5721_low_36
NF5721_low_36
[»] chr2 (6 HSPs)
chr2 (18-164)||(43206292-43206438)
chr2 (18-84)||(43227882-43227948)
chr2 (18-87)||(43224078-43224147)
chr2 (18-82)||(43213348-43213412)
chr2 (18-82)||(41650211-41650275)
chr2 (18-82)||(41654751-41654815)
[»] chr8 (3 HSPs)
chr8 (34-68)||(31839458-31839492)
chr8 (18-71)||(5073627-5073680)
chr8 (31-68)||(26262851-26262888)


Alignment Details
Target: chr2 (Bit Score: 118; Significance: 2e-60; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 18 - 164
Target Start/End: Complemental strand, 43206438 - 43206292
Alignment:
18 ataggaactggtcttcctccttttgttgctcttagagctgatatggatgctcttcttattcaggtctacannnnnnncttcttaaggttttggttttcaa 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||| |||||||||||||    
43206438 ataggaactggtcttcctccttttgttgctcttagagctgatatggatgctcttcttattcaggtctactttttgttcttcttaagattttggttttcaa 43206339  T
118 ttatgatcatggattttatctgggtttgatgaaaaggaaaaacaaac 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
43206338 ttatgatcatggattttatctgggtttgatgaaaaggaaaaacaaac 43206292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 43227948 - 43227882
Alignment:
18 ataggaactggtcttcctccttttgttgctcttagagctgatatggatgctcttcttattcaggtct 84  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||    
43227948 ataggaactggtcttcctccttttgttgctcttagagctgacatggatgctcttctcatgcaggtct 43227882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 18 - 87
Target Start/End: Complemental strand, 43224147 - 43224078
Alignment:
18 ataggaactggtcttcctccttttgttgctcttagagctgatatggatgctcttcttattcaggtctaca 87  Q
    |||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || ||||||||||    
43224147 ataggaactggtcttcctccttttgtcgctcttagagctgacatggatgctcttctcatgcaggtctaca 43224078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 43213412 - 43213348
Alignment:
18 ataggaactggtcttcctccttttgttgctcttagagctgatatggatgctcttcttattcaggt 82  Q
    |||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||    
43213412 ataggaactggtcttcctccttttgtcgctcttagagctgagatggatgctcttcttatgcaggt 43213348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 41650211 - 41650275
Alignment:
18 ataggaactggtcttcctccttttgttgctcttagagctgatatggatgctcttcttattcaggt 82  Q
    |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| || |||||    
41650211 ataggaactggtcttcctccttttgtagctctcagagctgatatggatgctcttctcatgcaggt 41650275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 41654751 - 41654815
Alignment:
18 ataggaactggtcttcctccttttgttgctcttagagctgatatggatgctcttcttattcaggt 82  Q
    |||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||| |||||    
41654751 ataggaactggtcttcctccttttgtcgctctcagagctgaaatggatgctcttcttatgcaggt 41654815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 68
Target Start/End: Complemental strand, 31839492 - 31839458
Alignment:
34 ctccttttgttgctcttagagctgatatggatgct 68  Q
    ||||||||||||||||||||||||| |||||||||    
31839492 ctccttttgttgctcttagagctgacatggatgct 31839458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 5073680 - 5073627
Alignment:
18 ataggaactggtcttcctccttttgttgctcttagagctgatatggatgctctt 71  Q
    |||||||||||  |  |||||||||||||| | |||||||||||||||||||||    
5073680 ataggaactggattgtctccttttgttgctttaagagctgatatggatgctctt 5073627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 31 - 68
Target Start/End: Original strand, 26262851 - 26262888
Alignment:
31 ttcctccttttgttgctcttagagctgatatggatgct 68  Q
    ||||||| |||||||||||||||||||| |||||||||    
26262851 ttcctccatttgttgctcttagagctgacatggatgct 26262888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University