View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5722-Insertion-5 (Length: 179)
Name: NF5722-Insertion-5
Description: NF5722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5722-Insertion-5 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 8 - 179
Target Start/End: Complemental strand, 38058687 - 38058516
Alignment:
| Q |
8 |
cgtcggaaccgtcattgctgctgcctttgctggttcatcggaataattttcatcctcatcgcgctccttggtattgccgccggcattttctaccttgttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38058687 |
cgtcggaaccgtcattgctgctgcctttgctggttcattggaataattttcatcctcatcgcgctccttggtattgccgccggcattttctaccttgttt |
38058588 |
T |
 |
| Q |
108 |
tccgtccaaaagcaccaaactacaccatcgaaaacatcaccattagaggaatcaacataacctcaccgtcat |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38058587 |
tccgtccaaaagcaccaaactacaccatcgaaaacatcaccattagaggaatcaacataacctcaccgtcat |
38058516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University