View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5722_high_18 (Length: 223)
Name: NF5722_high_18
Description: NF5722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5722_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 11900778 - 11900983
Alignment:
| Q |
1 |
aatcttatgcatgtccttaagattagagattggttctaccatgtaatttaatgatttactcacttttttgtgaaattcatctttgtcaccatactaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
11900778 |
aatcttatgcatgtccttaagattagagattggttctaccatgtaatttaatgatttactcacttttttgtgaaattcatctttgtcaacatactaattt |
11900877 |
T |
 |
| Q |
101 |
tgtatcaattgtcataatctaggnnnnnnnnnnagtcagcatataatattgcaacaaacccggcacaaggtgtactaaacgggta-gcgaaactttacaa |
199 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
11900878 |
tgtatcaattgtcataatctaggtttttttttgaatcagcatatattattgcaacaaacccggcacaaggcgtactaaacgggtaggcgaaacattacaa |
11900977 |
T |
 |
| Q |
200 |
ccaaag |
205 |
Q |
| |
|
|||||| |
|
|
| T |
11900978 |
ccaaag |
11900983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 118
Target Start/End: Original strand, 5086743 - 5086842
Alignment:
| Q |
19 |
aagattagagattggttctaccatgtaatttaatgatttactcacttttttgtgaaattcatctttgtcaccatactaattttgtatcaattgtcataat |
118 |
Q |
| |
|
|||||||||||| ||||| ||||||| |||| ||| |||||||||||||| |||||||||||||| |||| | | ||||||||| |||||||||||| |
|
|
| T |
5086743 |
aagattagagatgggttcagccatgtagtttatagatcgactcacttttttgtaaaattcatctttgtgaccaaagtgattttgtattaattgtcataat |
5086842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University