View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5722_low_11 (Length: 283)
Name: NF5722_low_11
Description: NF5722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5722_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 16 - 267
Target Start/End: Complemental strand, 52036167 - 52035919
Alignment:
| Q |
16 |
gaacctgtgtatagtgaatttgtgcaacaccaatagagattcttattaaatggaataaatgcaattgctcgttgttgtgaacttaattagcattcgcaat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52036167 |
gaacctgtgtatagtgaatttgtgcaacaccaatagagattcttattaaatggaataaatgcaattggtcgttgttgtgaacttaattagcattcgcaat |
52036068 |
T |
|
| Q |
116 |
tattgtttacttgctgtatagaatctcaaacagactaacaacagtagttgccttgcctaatgttgaggcatcccctgttcccacagaaaacggttaaata |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
52036067 |
tattgtttacttgttgtatagaatctcaaacagactaacaacagtagttgccttgccttatgttgaggcatcccctgttcccacagaaaacggtta---a |
52035971 |
T |
|
| Q |
216 |
atggttaatgtaatctattgagtggtttatcaattccatcctcttacatttt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035970 |
atggttaatgtaatctattgagtggtttatcaattccatcctcttacatttt |
52035919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University