View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723-Insertion-14 (Length: 151)
Name: NF5723-Insertion-14
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723-Insertion-14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 8 - 78
Target Start/End: Original strand, 34748670 - 34748740
Alignment:
| Q |
8 |
atgctcaatcaaaattggccaatattttgcatgctaaagaaatagctagacaactcaaggttagattaatt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34748670 |
atgctcaatcaaaattggccaatattttgcatgctaaagaaatagctagacaactcaaggttagattaatt |
34748740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 112 - 151
Target Start/End: Original strand, 34748766 - 34748805
Alignment:
| Q |
112 |
tttattgtctcatatgtgaatatataatcatcagattgct |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34748766 |
tttattgtctcatatgtgaatatataatcatcacattgct |
34748805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University