View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723_high_16 (Length: 287)
Name: NF5723_high_16
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 4 - 143
Target Start/End: Original strand, 25655904 - 25656043
Alignment:
| Q |
4 |
cggatgtcgaagaatatattgtggataggattaaaacaacctcttgcatgtgggttttagcggnnnnnnnggggggccttgtttgtcatacaagtggttc |
103 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
25655904 |
cggatgtcgaagattatattgtggataggattaaaacaacctcttgcatgtgggttttagcggaaaaaaaggggggccttgtttgtaatacaagtggttc |
25656003 |
T |
|
| Q |
104 |
tcgaaccctcatttttgtttaacatcctaagtttaatagt |
143 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
25656004 |
tcgaaccctcttttttgtttaatatcctaagtttaatagt |
25656043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 165 - 213
Target Start/End: Original strand, 7441646 - 7441694
Alignment:
| Q |
165 |
accccttatattgttcccgagttgtgggttaagtactttttgtacttct |
213 |
Q |
| |
|
|||||||||| | |||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
7441646 |
accccttatacttttcctgagttgcgggttaagtactctttgtacttct |
7441694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University