View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723_high_23 (Length: 241)
Name: NF5723_high_23
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 18 - 225
Target Start/End: Original strand, 46953188 - 46953395
Alignment:
| Q |
18 |
attaaatatacgtaccatgcaccattgaaggctaaggaggtaggcctcttaataggaaagaagccaagaacattgacgtaaaaatcaacagacttgtcta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46953188 |
attaaatatacgtaccatgcaccattgaaggctaaggaggtaggcctcttaataggaaagaagccaagaacattgacgtaaaaatcaactgacttgtcta |
46953287 |
T |
 |
| Q |
118 |
atgatctacacaccaatgagatgtgattcaatgatttgagttgcaggggattgcccattccttcttgattttcttttaccttatgtcacaaataattgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46953288 |
atgatctacacaccaatgagatgtgattcaatgatttgagttgcaggggattgcccattccttcttgattttcttttaccttatgtcacaaataattgaa |
46953387 |
T |
 |
| Q |
218 |
tgaaatac |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
46953388 |
tgaaatac |
46953395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University