View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723_high_29 (Length: 237)
Name: NF5723_high_29
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 26 - 222
Target Start/End: Original strand, 33501670 - 33501866
Alignment:
| Q |
26 |
gccgataagaaaaacagaaaacaccacacaatgggaaaatcaggctaaacgtggggcgtcacatacttcttgcaatggaaagaatcacatctcaacgatg |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33501670 |
gccgataagaaaaacagaaaacaccacacaatgggaaaatcaggttaaacgtgaggcgtcacatacttcttgcaatgggaagaatcacatctcaacgatg |
33501769 |
T |
|
| Q |
126 |
aaaataatcggacgaggttagattttgtaggtcactatattttggctagcaggacaagttttgtctataaattaataacgcacctttacatttcatt |
222 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33501770 |
aaaataatcggacgaggttagattttataggtcactatattttggccagcagaacaagttttttctataaattaataacgcacctttacatttcatt |
33501866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University