View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723_high_7 (Length: 380)
Name: NF5723_high_7
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 50 - 151
Target Start/End: Original strand, 25656067 - 25656168
Alignment:
| Q |
50 |
gttaaggtgatcagtcttaatttttctgggtcaagtagtttgattgttataattcactttataagatgatcactcttgatttttactcggtcaacatatg |
149 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||| || |
|
|
| T |
25656067 |
gttaaggtgatcagtcttgatttttctgggtcaagtagtttgattgctagaattcactttataagatgatcactcttgatttttacccggtcaacatgtg |
25656166 |
T |
|
| Q |
150 |
ga |
151 |
Q |
| |
|
|| |
|
|
| T |
25656167 |
ga |
25656168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 211 - 261
Target Start/End: Original strand, 25656229 - 25656279
Alignment:
| Q |
211 |
tgataaatcacttcttannnnnnnccacctcttgcattatcttctccatac |
261 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25656229 |
tgataaatcacttcttatttttttccacctcttgcattatcttctccatac |
25656279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University