View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723_low_12 (Length: 314)
Name: NF5723_low_12
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723_low_12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 16 - 314
Target Start/End: Original strand, 16700314 - 16700614
Alignment:
| Q |
16 |
caagagtaatcatgaatggtgaaaactcactgagtggagcaggagggttccagcacggttttagtgctttatcattttgcttcaatggctttttggttag |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
16700314 |
caagagtaatcatgaatggtgaaaacttactgagtggagcaggagggttccagcacggttttagtgctttatcattttgcttcaatggctttttggtaag |
16700413 |
T |
 |
| Q |
116 |
atgtgaaacggttgccatgttttcttgagtaactgttacagagtcttgttgggaaacttctgtagcttgaacttcaatcttgacatggtttagtgcaaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16700414 |
atgtgaaacggttgccatgttttcttgagtaactgttacagagtcttgttgggaaacttctgtagcttgaacttcaatcttgacatggtttagtgcaaac |
16700513 |
T |
 |
| Q |
216 |
aaaaattcttaagtaactttgttcaataatccacaagttttacataaccatcatattaatatcacataatccaacaaa--atattataaacaaactatta |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
16700514 |
aaaaattcttaagtaactttgttcaataatccaaaagttttacataaccatcatattaatatcacataatccaacaaaatatattataaacaaactatta |
16700613 |
T |
 |
| Q |
314 |
a |
314 |
Q |
| |
|
| |
|
|
| T |
16700614 |
a |
16700614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University