View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723_low_15 (Length: 293)
Name: NF5723_low_15
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723_low_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 54701459 - 54701747
Alignment:
| Q |
1 |
tactatgacgctaacttgtattctcatttcttagttatctttattttcagagaaaaacaatggcaggtgatgtagaaacgaaccccaaaagctctctgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54701459 |
tactatgacgctaacttgtattctcatttcttagttatctttattttcagagaaaaacaatggcaggtgatgtagaaacgaaccccaaaagctctctgca |
54701558 |
T |
 |
| Q |
101 |
tagtcgcagcaacgactagcttaccctcggcatcacaccctaccgtatcacatcatcaataagtcacacactcgatgacttgcaggatttgtataggcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
54701559 |
tagtcgcagcaacgactagcttaccctcggcatcacaccctaccgtatcacatcatcaataagtcacacactcgataacttgcaggatttgtataggcac |
54701658 |
T |
 |
| Q |
201 |
atatatataagctactccacatgacaatttcccaaccagcattggcacgataaggcagcgagacaccagttgatgaactatttgatggatcta |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
54701659 |
----atataagctactccacatgacaatttcccaacaagcattggcacgataaggcagcgagaaacaagttgatgaactatttgatggatcta |
54701747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University