View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723_low_18 (Length: 274)
Name: NF5723_low_18
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 94 - 254
Target Start/End: Original strand, 784825 - 784985
Alignment:
| Q |
94 |
ctccccatcaagtgcaaaccatatttatattgttcacacatagttcaaccatctattataaccataaagtgcttgaaccataacataaatatttcacttc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
784825 |
ctccccatcaagtgcaaaccatatttatattgttcacacatagttcaaccatctattataaccataaagtgcttgaaccataacataaatatttcacttc |
784924 |
T |
 |
| Q |
194 |
tcgatctcatgtcagatttctaaaacattattaatgcatcctttaccttatgaatgaacaa |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
784925 |
tcgatctcatgtcagatttctaaaacattattaatgtatcctttaccttatgaatgaacaa |
784985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 784732 - 784787
Alignment:
| Q |
1 |
atccgaaagaacttgattgaatcgagattgaacaacacatagttcaaccaagttaa |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
784732 |
atccgaaagaacttgattgaatcgagattgaacaacacatagttcaaccaagttaa |
784787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University