View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723_low_20 (Length: 252)
Name: NF5723_low_20
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723_low_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 54 - 252
Target Start/End: Complemental strand, 46953838 - 46953640
Alignment:
| Q |
54 |
acttcacactggatgaggattagtagttcatagaaaattcctagctggtagtttttccacctaattgcaagtttcctccatggaggattaatgtttatct |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46953838 |
acttcacactggatgaggattagtagttcatagaaaattcctagctggtagtttttccacctaattgcaagtttcctccatggaggattaatgcttatct |
46953739 |
T |
 |
| Q |
154 |
tagtgtttttgatccctgggcagtgacacatgcattttgattttctcagttgctaaacaaaacttgtaaaaatagaccaagacaaacacggtgttacgt |
252 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46953738 |
tattgtttttgatccctgggcagtgacacatgcattttgattttctcagttgctaaacaaaacttgtaaaaatagaccaagacaaacacggtcttacgt |
46953640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University