View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723_low_21 (Length: 250)
Name: NF5723_low_21
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 35145721 - 35145878
Alignment:
| Q |
1 |
catcacaaaatttaacttgttgaaagagaaaaaatattatgacaatactagagtagtattttgtttaagagtgtgagtctacccgtatgtataccttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
35145721 |
catcacaaaatttaacttgttgaaagagaaaaaatattatgacaatactagagtagtattttgtttaagagtgtgattccacccgtatgtataccttgct |
35145820 |
T |
|
| Q |
101 |
tgaaaggtatcagttttggagtcatagctaagcaaggcctcgtgaacatatagtccct |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35145821 |
tgaaaggtatcagttttggagtcatagctaagcaaggcctcgtgaacatatagtccct |
35145878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 205 - 242
Target Start/End: Original strand, 35145898 - 35145935
Alignment:
| Q |
205 |
ctcgttttaagaattttgatatgactccggagaataat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35145898 |
ctcgttttaagaattttgatatgactccggagaataat |
35145935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University