View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723_low_32 (Length: 221)
Name: NF5723_low_32
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 49170896 - 49171078
Alignment:
| Q |
16 |
aagaatatagtaagggcttggttgtctctaaaactttgttgtttacagatagtaaagaaaggaccacatgccaaagagtataatcacaaatttat-cttt |
114 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
49170896 |
aagaatataataagggcttggttgtctctaaaactttgttgtttgcagatagtaaagaaaggaccacatgccaaagagtataatcacaaatttatgtttt |
49170995 |
T |
|
| Q |
115 |
ttcttttctggtctaacaagaggagtttgacgtgagttatgtagagagggtatgttacacttttcttgctcaattgttattgg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
49170996 |
ttcttttctggtctaacaagaggagtttgacgtgagttatgtagagagggtaggttacacttttcttgctcaattgtgattgg |
49171078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 24 - 197
Target Start/End: Complemental strand, 8421210 - 8421037
Alignment:
| Q |
24 |
agtaagggcttggttgtctctaaaactttgttgtttacagatagtaaagaaaggaccacatgccaaagagtataatcacaaatttatctttttcttttct |
123 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8421210 |
agtaaggtcttggttgtctctaaaactttgttgtttgcagatagtaaagaaaggaccacatgccaaagagtataatcacaaatttatgtttttcttttca |
8421111 |
T |
|
| Q |
124 |
ggtctaacaagaggagtttgacgtgagttatgtagagagggtatgttacacttttcttgctcaattgttattgg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
8421110 |
ggtctaacaagaggagtttgacgtgagttatgtagagagggtaggttacacttttcttgctcaattgtgattgg |
8421037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University