View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5723_low_6 (Length: 381)
Name: NF5723_low_6
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5723_low_6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 381
Target Start/End: Original strand, 6365062 - 6365437
Alignment:
| Q |
18 |
agtaacacgttatagctattccaaaatttgatgttttttacagctcaaatgttctttatacctactacat-------------ccacttgcccttaatta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6365062 |
agtaacacgttatagctattccaaaatttgatgttttttacagctcaaatgttctttatacctactacataatttctcaacatccacttgcccttaatta |
6365161 |
T |
|
| Q |
105 |
tatcaaattgaaaactaaattttaatattttagtggtaattgatagtaactggttatttatgaataatatttgggtattgttaaaataagataaagaagt |
204 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6365162 |
tatcaaattgaaa-ctaaattttaatattttagtggtaattgatagtaactggttatttatgaataatatttgggtattgttaaaataagataaagaagt |
6365260 |
T |
|
| Q |
205 |
tgttaccatcagcaacggtagcactaatcagccagagagccacagaacggcggaacaaggcggtggcagtgtcaagtacagtaccggcaacatcaccagc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||||| | |
|
|
| T |
6365261 |
tgttaccatcagcaacggtagcactaatcagccagagagccacagaacggcggaacaaggaggtggcagtgtcagctacagtaccggcagcatcaccaac |
6365360 |
T |
|
| Q |
305 |
aaaatcgaagataccgccaaatgcaccaccggcgctttgagctgcagtcagttcgttgatgtctaagacattctttt |
381 |
Q |
| |
|
||||||||||| || | ||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6365361 |
aaaatcgaagaaactgtcaactacaccaccggcgctttgagctgcagtgagttcgttgatgtctaagacattctttt |
6365437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University