View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5723_low_7 (Length: 380)

Name: NF5723_low_7
Description: NF5723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5723_low_7
NF5723_low_7
[»] chr5 (2 HSPs)
chr5 (50-151)||(25656067-25656168)
chr5 (211-261)||(25656229-25656279)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 50 - 151
Target Start/End: Original strand, 25656067 - 25656168
Alignment:
50 gttaaggtgatcagtcttaatttttctgggtcaagtagtttgattgttataattcactttataagatgatcactcttgatttttactcggtcaacatatg 149  Q
    |||||||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||| |||||||||| ||    
25656067 gttaaggtgatcagtcttgatttttctgggtcaagtagtttgattgctagaattcactttataagatgatcactcttgatttttacccggtcaacatgtg 25656166  T
150 ga 151  Q
    ||    
25656167 ga 25656168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 211 - 261
Target Start/End: Original strand, 25656229 - 25656279
Alignment:
211 tgataaatcacttcttannnnnnnccacctcttgcattatcttctccatac 261  Q
    |||||||||||||||||       |||||||||||||||||||||||||||    
25656229 tgataaatcacttcttatttttttccacctcttgcattatcttctccatac 25656279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University