View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5724_low_4 (Length: 250)

Name: NF5724_low_4
Description: NF5724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5724_low_4
NF5724_low_4
[»] chr3 (2 HSPs)
chr3 (47-164)||(33388412-33388530)
chr3 (188-250)||(33388327-33388389)
[»] chr7 (1 HSPs)
chr7 (46-113)||(49035298-49035366)


Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 47 - 164
Target Start/End: Complemental strand, 33388530 - 33388412
Alignment:
47 tgttttcattgtttagttgctctacttt-taaatattggtttgacaccgttgtttttctttggtacaccttttattagggaggatattttgtggtaatat 145  Q
    ||||||||||| |||||||||||||||| ||||||| | ||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||    
33388530 tgttttcattgcttagttgctctactttgtaaatatagatttgacaccgttgtttttctttgatacaccttttattagggaggacattttatggtaatat 33388431  T
146 atttatttttagcttttta 164  Q
    ||||  |||||||||||||    
33388430 atttcattttagcttttta 33388412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 188 - 250
Target Start/End: Complemental strand, 33388389 - 33388327
Alignment:
188 gatcaaataatgcaaagactaatacaatatttaaacatttagttgtggtagttgcctccaata 250  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
33388389 gatcaaataatgcaaagactaatacaatatttaaacatttagttgtggtagttgtctccaata 33388327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 113
Target Start/End: Complemental strand, 49035366 - 49035298
Alignment:
46 ttgttttcattgtttagttgctctacttt-taaatattggtttgacaccgttgtttttctttggtacac 113  Q
    |||| |||||||||| |||| | |||||| ||||||||||||||||||  ||||||||| |||||||||    
49035366 ttgtcttcattgttttgttgttttactttgtaaatattggtttgacactattgtttttccttggtacac 49035298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University