View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5724_low_4 (Length: 250)
Name: NF5724_low_4
Description: NF5724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5724_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 47 - 164
Target Start/End: Complemental strand, 33388530 - 33388412
Alignment:
| Q |
47 |
tgttttcattgtttagttgctctacttt-taaatattggtttgacaccgttgtttttctttggtacaccttttattagggaggatattttgtggtaatat |
145 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| | ||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
33388530 |
tgttttcattgcttagttgctctactttgtaaatatagatttgacaccgttgtttttctttgatacaccttttattagggaggacattttatggtaatat |
33388431 |
T |
 |
| Q |
146 |
atttatttttagcttttta |
164 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
33388430 |
atttcattttagcttttta |
33388412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 188 - 250
Target Start/End: Complemental strand, 33388389 - 33388327
Alignment:
| Q |
188 |
gatcaaataatgcaaagactaatacaatatttaaacatttagttgtggtagttgcctccaata |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33388389 |
gatcaaataatgcaaagactaatacaatatttaaacatttagttgtggtagttgtctccaata |
33388327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 46 - 113
Target Start/End: Complemental strand, 49035366 - 49035298
Alignment:
| Q |
46 |
ttgttttcattgtttagttgctctacttt-taaatattggtttgacaccgttgtttttctttggtacac |
113 |
Q |
| |
|
|||| |||||||||| |||| | |||||| |||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
49035366 |
ttgtcttcattgttttgttgttttactttgtaaatattggtttgacactattgtttttccttggtacac |
49035298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University