View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5724_low_7 (Length: 227)
Name: NF5724_low_7
Description: NF5724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5724_low_7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 33387917 - 33388138
Alignment:
| Q |
6 |
aatacttgtagactcactttggatactgtttgttacgacatgtggtgcaacaatgcccttcgggaccctccaacgccatctcaatgctcaacaactagct |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33387917 |
aatacttgtaaactcactttggatactgtttgttacgacatgtggtgcaacaatgcccttggggaccctccaacgccatctcaatgctcaacaactagct |
33388016 |
T |
|
| Q |
106 |
taaatgcgatgttgattgtgcttactagaaagtatgtatcacggtcaaattcaaatacnnnnnnnnnatcatcatctaaattgtattgattttattatca |
205 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
33388017 |
taaatgcgatgttgattgcgcttactataaagtatgtatcacggtcaaattcaaatactttttttttatcatcatctaaattgtactgattttattatca |
33388116 |
T |
|
| Q |
206 |
ttgatgaaatgaagtgagttac |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33388117 |
ttgatgaaatgaagtgagttac |
33388138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University