View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5725-Insertion-16 (Length: 43)
Name: NF5725-Insertion-16
Description: NF5725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5725-Insertion-16 |
 |  |
|
| [»] chr3 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 32; Significance: 0.0000000006; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.0000000006
Query Start/End: Original strand, 12 - 43
Target Start/End: Original strand, 6165875 - 6165906
Alignment:
| Q |
12 |
caactatgattagaaaacaccaaatttcactg |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6165875 |
caactatgattagaaaacaccaaatttcactg |
6165906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.0000000006
Query Start/End: Original strand, 8 - 43
Target Start/End: Original strand, 6235066 - 6235101
Alignment:
| Q |
8 |
ggttcaactatgattagaaaacaccaaatttcactg |
43 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6235066 |
ggttcaactatgattagaaaataccaaatttcactg |
6235101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.0000000006
Query Start/End: Original strand, 8 - 43
Target Start/End: Original strand, 6242230 - 6242265
Alignment:
| Q |
8 |
ggttcaactatgattagaaaacaccaaatttcactg |
43 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6242230 |
ggttcaactatgattaaaaaacaccaaatttcactg |
6242265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 14 - 43
Target Start/End: Original strand, 6879563 - 6879592
Alignment:
| Q |
14 |
actatgattagaaaacaccaaatttcactg |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6879563 |
actatgattagaaaacaccaaatttcactg |
6879592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 27; E-Value: 0.0000006
Query Start/End: Original strand, 9 - 43
Target Start/End: Original strand, 6256186 - 6256219
Alignment:
| Q |
9 |
gttcaactatgattagaaaacaccaaatttcactg |
43 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
6256186 |
gttcaactatgattagaaaa-accaaatttcactg |
6256219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University