View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5725_high_32 (Length: 247)
Name: NF5725_high_32
Description: NF5725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5725_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 38982422 - 38982202
Alignment:
| Q |
1 |
aatttctgatatataatctttatttattagaaaatatgcatnnnnnnntaatatannnnnnnnnnnnggtatatcgggcacatgtttgcatttttaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
38982422 |
aatttctgatatataatctttatttattagaaaatatgcataaaaaaataatatattttttatttttggtatatcgggcaaatgtttgcatttttaaatt |
38982323 |
T |
|
| Q |
101 |
gatctccaattttgtaaaacgtttctcacattcttagccactaaagctgccttcaaggattcgactatgtaaaaccgtctcaaatttatcaatgaaactt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
38982322 |
gatctccaattttgtaaaacgtttctcacattcttagccactaaagctgccttcaaggactcgactatgtaaaaccgtctcaaatttatcaacgaaacct |
38982223 |
T |
|
| Q |
201 |
ctttaacaaccaactacttca |
221 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
38982222 |
cttgaacaaccaactacttca |
38982202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University