View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5725_high_6 (Length: 483)
Name: NF5725_high_6
Description: NF5725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5725_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 3e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 168 - 284
Target Start/End: Complemental strand, 20248790 - 20248673
Alignment:
| Q |
168 |
tgtcaaacaaatgatgt-aaccctgatgacagaacaattgctttaaatgaaaacttcaatgcatatgaagttatgggtataaaaaagaaggatggtgtat |
266 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20248790 |
tgtcaaacaaattatgttaactctgatgacagaacaattgctttgaatgaaaacttcaatgcatctgaagttatgggtataaaaaagaaggatggtgtat |
20248691 |
T |
 |
| Q |
267 |
ccagaagaaaaggtagac |
284 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
20248690 |
ccagaggaaaaggtagac |
20248673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 116 - 170
Target Start/End: Complemental strand, 23881429 - 23881375
Alignment:
| Q |
116 |
attagccacacatgttgaaatctcatatgttataaaagtttgtactctgtgctgt |
170 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
23881429 |
attagccacacatgttgaaatctcatctgttataaaagtttgtactctatgctgt |
23881375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 52610618 - 52610686
Alignment:
| Q |
102 |
atgttgttattggcattagccacacatgttgaaatctcatatgttataaaagtttgtactctgtgctgt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||| |
|
|
| T |
52610618 |
atgttgttattggcattagccacacatgttgaaatctcatctgttataaaagtttgcactctatgctgt |
52610686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 102 - 159
Target Start/End: Original strand, 31330946 - 31331003
Alignment:
| Q |
102 |
atgttgttattggcattagccacacatgttgaaatctcatatgttataaaagtttgta |
159 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||| |||||||||| |||||| |
|
|
| T |
31330946 |
atgttgttattggcattagccacatgtgttgaaattccatctgttataaaaatttgta |
31331003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University