View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5725_low_24 (Length: 292)
Name: NF5725_low_24
Description: NF5725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5725_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 38 - 283
Target Start/End: Complemental strand, 29575984 - 29575739
Alignment:
| Q |
38 |
tgcaatcatattgccctaacctctccttagcttccattatatcttgtgtcacaaatttcatcctcttttcaagtgctttatccgaagccacgatcttgct |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29575984 |
tgcaatcatattgccctaacctctccttagcttccattatatcttgtgtcacaaatttcatcctcttttcaagtgctttatccgaagccacgatcttgct |
29575885 |
T |
 |
| Q |
138 |
agcaacctcattagctttctcatcgatatcaaaattatcaaagtgagttgattccatgtgatgagttgccaatataattgaacttagtggcattggacca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29575884 |
agcaacctcattagctttctcatcgatatcaaaattatcaaagtgagttgattccatgtgatgagttgccaatataattgaacttagtggcattggacca |
29575785 |
T |
 |
| Q |
238 |
gatcctataaaagctacnnnnnnngcatccactacaccattttctt |
283 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29575784 |
gatcctataaaagctactttttttgcatccactacaccattttctt |
29575739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University