View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5725_low_26 (Length: 289)
Name: NF5725_low_26
Description: NF5725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5725_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 9 - 287
Target Start/End: Complemental strand, 37497820 - 37497555
Alignment:
| Q |
9 |
aacagagaccacaatgaaaatcttagttgagccctagtatcaattttctccctccaaatttcttttatgaaaaatttgcacagtagttacagtttgcata |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37497820 |
aacagaaaccacaatgaaaatcttagttgagccctagtatcaattttctccctccaaatttcttttatgaaaaatttgcacagtagttacagtttgcata |
37497721 |
T |
 |
| Q |
109 |
gcgcaagaggcacaaaaaacatgcattcaagacacattttttgtccataatttaatttcagtatacaattgnnnnnnnggagttatttttattgggtgta |
208 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||| |||||| |
|
|
| T |
37497720 |
gcgcaagcggcacaaaaaacatgcattcaagacacattttttgtccataatttaatttcagtatacaattgaaaaaaagaagttatctttatt------- |
37497628 |
T |
 |
| Q |
209 |
gggagagggtgtaaaaattaaagaatgataattataaaatcaaagttcattgataaagtagtattgtagaatgcagata |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37497627 |
------gggtgtaaaaattaaagaatgataattataaaatcaaagttcattgataaagtagtattgtagaatgcagata |
37497555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University